WormBase Tree Display for Feature: WBsf975993
expand all nodes | collapse all nodes | view schema
| WBsf975993 | SMap | S_parent | Sequence | F29F11 |
|---|---|---|---|---|
| Name | Public_name | DE3 | ||
| Sequence_details | Flanking_sequences | agtaaaaaagtatagagaagaggatattgt | caaaagccaaaattgttgatgaggaagatt | |
| Mapping_target | F29F11 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the 'DE3' enhancer region in the distal enhancer region for ceh-22. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00006411 | ||
| Associations | Associated_with_gene | WBGene00000445 | ||
| Associated_with_Interaction | WBInteraction000524106 | |||
| Associated_with_expression_pattern | Expr11804 | |||
| Associated_with_construct | WBCnstr00019435 | |||
| Method | enhancer |
