WormBase Tree Display for Feature: WBsf954643
expand all nodes | collapse all nodes | view schema
WBsf954643 | SMap | S_parent | Sequence | ZK1290 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | atacagaaaattaattaaaattaatttcag | caaggatcccaaaccaaaatcgctgtcaga | |
Mapping_target | ZK1290 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 | 12 | |
RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX151617 | 8 | |||
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR493077.91989744.+.SL1 - 57M) from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 with 12 reads | |||
Defined by RNASeq data (example read: SRR504336.15863737.+.SL1 - 81M) from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX151617 with 8 reads | ||||
Defined by RNASeq data (example read: SRR474827.12743719.+.SL1 - 86M) from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 with 1 reads | ||||
Method | SL1 |