WormBase Tree Display for Feature: WBsf952111
expand all nodes | collapse all nodes | view schema
WBsf952111 | SMap | S_parent | Sequence | F01D5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | gtctttatgaaactaaatatatattttcag | ctaaatatgtcaaccccagcccgtaaaccc | |
Mapping_target | F01D5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 trans-splice leader acceptor site | ||
SO_term | SO:0000706 | |||
Defined_by | Defined_by_analysis | RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 | 1 | |
RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 | 1 | |||
RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 | 3 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 1 | |||
Remark | Defined by RNASeq data (example read: SRR089796.14412828.+.SL2f - 28M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 1 reads | |||
Defined by RNASeq data (example read: SRR332922.3522163.+.SL2f - 39M47N51M) from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 1 reads | ||||
Defined by RNASeq data (example read: SRR136597.10862514.+.SL2k - 27M) from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 3 reads | ||||
Defined by RNASeq data (example read: SRR031115.15840037.+.SL2b - 25M) from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | ||||
Method | SL2 |