WormBase Tree Display for Feature: WBsf919639
expand all nodes | collapse all nodes | view schema
| WBsf919639 | SMap | S_parent | Sequence | T18D3 |
|---|---|---|---|---|
| Name | Public_name | PHA-4 binding site | ||
| Sequence_details | Flanking_sequences | gtactcattgttctggataaaattctctcg | cgtcggatgtctgcctctctgcattgagcc | |
| Mapping_target | T18D3 | |||
| DNA_text | ttgtttgc | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Binding site for the PHA-4 transcription factor, within the promoter of myo-2 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00004526 | ||
| Associations | Associated_with_gene | WBGene00202278 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000020 | |||
| Bound_by_product_of | WBGene00003514 | |||
| Method | TF_binding_site |
