WormBase Tree Display for Feature: WBsf919632
expand all nodes | collapse all nodes | view schema
WBsf919632 | SMap | S_parent | Sequence | F01D4 |
---|---|---|---|---|
Name | Public_name | UNC-86 binding site (u2b) | ||
Sequence_details | Flanking_sequences | atccttacacacactttctagcttcataag | ctattatcgtcaccatttggagacaccagt | |
Mapping_target | F01D4 | |||
DNA_text | aaatgcat | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Binding site for UNC-86 transcritpion factor (u2b), within the promoter region of mec-3 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00001664 | ||
Associations | Associated_with_gene | WBGene00003167 | ||
Associated_with_Interaction | WBInteraction000524124 | |||
WBInteraction000524240 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000094 | |||
Bound_by_product_of | WBGene00006818 | |||
Method | TF_binding_site |