WormBase Tree Display for Feature: WBsf919607
expand all nodes | collapse all nodes | view schema
| WBsf919607 | SMap | S_parent | Sequence | T18D3 |
|---|---|---|---|---|
| Name | Public_name | DAF-3 binding site | ||
| Sequence_details | Flanking_sequences | ctggataaaattctctcgttgtttgccgtcggat | cctctctgcattgagccggcttcttcactatct | |
| Mapping_target | T18D3 | |||
| DNA_text | GTCTG | |||
| Origin | Species | Caenorhabditis elegans | ||
| History | Acquires_merge | WBsf919641 | ||
| Visible | Description | This is the co-SMAD factor DAF-3 binding site GTCTG in the 'C183' region enhancer for myo-2. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00003384 | ||
| Associations | Associated_with_gene | WBGene00003514 | ||
| Associated_with_Interaction | WBInteraction000521671 | |||
| WBInteraction000556899 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000472 | |||
| Bound_by_product_of | WBGene00000899 | |||
| Remark | This is the co-SMAD factor DAF-3 binding site GTCTG in the 'C183' region enhancer for myo-2. This negatively regulates myo-2. [2013-07-23 gw3] | |||
| Method | TF_binding_site |
