WormBase Tree Display for Feature: WBsf919544
expand all nodes | collapse all nodes | view schema
| WBsf919544 | SMap | S_parent | Sequence | VF23B12L |
|---|---|---|---|---|
| Name | Public_name | TRA-1 binding site | ||
| Sequence_details | Flanking_sequences | cagctcaattattaaattttattgggtattgttta | cataaaattctattgtcccagatttaggatacatcg | |
| Mapping_target | VF23B12L | |||
| DNA_text | CTCCTAACCGGGTGGTC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is a TRA-1 binding site that represses egl-1. | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00003631 | ||
| Associations | Associated_with_gene | WBGene00001170 | ||
| Associated_with_Interaction | WBInteraction000520178 | |||
| WBInteraction000521662 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000029 | |||
| Bound_by_product_of | WBGene00006604 | |||
| Remark | This is the TF_binding_site for TRA-1 which silences egl-1. [2013-07-23 gw3] | |||
| Method | TF_binding_site |
