WormBase Tree Display for Feature: WBsf919538
expand all nodes | collapse all nodes | view schema
| WBsf919538 | SMap | S_parent | Sequence | F55B12 |
|---|---|---|---|---|
| Name | Public_name | 'vulval muscle' enhancer | ||
| Sequence_details | Flanking_sequences | gcttcactttccacttgctccactttaccattgg | aaaagtgcctctttccgcccagatctccagaattcgtt | |
| Mapping_target | F55B12 | |||
| DNA_text | TCCTTCTCGATTTCAAAATGTCAACTAAACATATGCAACATATGTGCC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | This is the 'vulval muscle' enhancer for ceh-24. | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00003015 | ||
| Associations | Associated_with_gene | WBGene00000447 | ||
| Associated_with_expression_pattern | Expr11281 | |||
| Associated_with_construct | WBCnstr00018732 | |||
| Remark | This is the 'vulval muscle' enhancer for ceh-24. [2013-07-23 gw3] | |||
| Method | enhancer |
