WormBase Tree Display for Feature: WBsf919536
expand all nodes | collapse all nodes | view schema
WBsf919536 | SMap | S_parent | Sequence | F29F11 |
---|---|---|---|---|
Name | Public_name | CEH-22 binding site | ||
Sequence_details | Flanking_sequences | ataaatatattgggtgctcatttgccgaac | agttcgagcactacacttgattattgttagccgagatg | |
Mapping_target | F29F11 | |||
DNA_text | CACTTAT | |||
Origin | Species | Caenorhabditis elegans | ||
History | Acquires_merge | WBsf019088 | ||
Visible | Description | TF binding site for CEH-22 (autoregulatory region). | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00005167 | ||
Associations | Associated_with_gene | WBGene00000445 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000061 | |||
Bound_by_product_of | WBGene00000445 | |||
Remark | TF binding site for CEH-22 (autoregulatory region) in the enhancer regions 'pe39 and pe41' in the 'proximal' enhancer region for ceh-22. [2013-07-23 gw3] | |||
Method | TF_binding_site |