WormBase Tree Display for Feature: WBsf919534
expand all nodes | collapse all nodes | view schema
WBsf919534 | SMap | S_parent | Sequence | F29F11 |
---|---|---|---|---|
Name | Public_name | Enhancer regions 'pe39' and 'pe41' | ||
Sequence_details | Flanking_sequences | ggatcattgcgaacacgaaatgagcataaatata | acttgattattgttagccgagatgctcataccccagcaa | |
Mapping_target | F29F11 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Enhancer regions 'pe39 and pe41' for ceh-22. | ||
SO_term | SO:0000165 | |||
Defined_by | Defined_by_paper | WBPaper00005167 | ||
Associations | Associated_with_gene | WBGene00000445 | ||
Associated_with_Interaction | WBInteraction000521704 | |||
WBInteraction000521706 | ||||
Associated_with_expression_pattern | Expr11279 | |||
Associated_with_construct | WBCnstr00018072 | |||
WBCnstr00018073 | ||||
Remark | Enhancer regions 'pe39 and pe41' in the 'proximal' enhancer region for ceh-22. [2013-07-23 gw3] | |||
Method | enhancer |