WormBase Tree Display for Feature: WBsf644485
expand all nodes | collapse all nodes | view schema
| WBsf644485 | SMap | S_parent | Sequence | F28C6 |
|---|---|---|---|---|
| Name | Public_name | MCP_0000009247 | ||
| Sequence_details | Flanking_sequences | caagccactttctctcgcttgttctacgag | ttgattgtgacatcggaacaggcgccagct | |
| Mapping_target | F28C6 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Clustered region of TSS sites. Number of tags=13. Shape score=0.538462. Assignement type=wormbase_tss. Mode position in cluster=17. | ||
| SO_term | SO:0001240 | |||
| Defined_by | Defined_by_paper | WBPaper00042246 | ||
| Score | 13 | |||
| Associations | Associated_with_gene | WBGene00009205 | ||
| Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
| Method | TSS_region |
