WormBase Tree Display for Feature: WBsf632464
expand all nodes | collapse all nodes | view schema
WBsf632464 | SMap | S_parent | Sequence | F25H9 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | tttgtcaatttttgaatgaaatgtttatat | aaactttgcaactaacaacaatttctacac | |||
Mapping_target | F25H9 | |||||
Source_location | 190 | CHROMOSOME_V | 13469047 | 13469046 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_sequence | elegans_PE_SS_GG1456|c7_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
elegans_PE_SS_GG1456|c7_g1_i2 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG1456|c7_g1_i3 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG1456|c7_g1_i4 | Inferred_automatically | make_missing_tsl_features.pl | ||||
elegans_PE_SS_GG1456|c7_g1_i8 | Inferred_automatically | make_missing_tsl_features.pl | ||||
Defined_by_paper | WBPaper00037808 | |||||
Associations | Associated_with_transcript | T10G3.1.1 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 5421.0 | ||||||
Method | polyA_site |