WormBase Tree Display for Feature: WBsf133149
expand all nodes | collapse all nodes | view schema
WBsf133149 | SMap | S_parent | Sequence | W10C8 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | TGAAAGCCAAATTTTGAAAAAAAAATTCAG | GTCTGTACGGAAGCTCAAGTGGGGATCAGG | |
Mapping_target | W10C8 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by | Defined_by_sequence | lin-35_n745_mid-L1_25dC_4.0hrs_post-L1_bundle_of_reads_supporting_SL1_I_2852665_2852666_-_wb170 | ||
Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 2 | ||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 | 2 | |||
RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 | 1 | |||
RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 | 2 | |||
Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 2 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 2 reads | ||||
Method | SL1 |