WormBase Tree Display for Feature: WBsf127141
expand all nodes | collapse all nodes | view schema
WBsf127141 | SMap | S_parent | Sequence | Y49E10 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | AGGGAAAATATTACAATATTTTACTTCCAG | AATCGGAGACCCAGCAACAACCACGGAAGC | |
Mapping_target | Y49E10 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by | Defined_by_sequence | Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_III_12428423_12428424_+_wb170 | ||
Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_III_12428422_12428423_+_wb170 | ||||
Defined_by_analysis | RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | ||
RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
RNASeq.elegans.N2.WBls:0000023.Hermaphrodite.WBbt:0007833.PRJNA174814.SRX185637 | 1 | |||
Remark | Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000023.Hermaphrodite.WBbt:0007833.PRJNA174814.SRX185637 with 1 reads | ||||
Method | SL1 |