WormBase Tree Display for Feature: WBsf034315
expand all nodes | collapse all nodes | view schema
WBsf034315 | SMap | S_parent | Sequence | C15C7 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | aaaatctggaggtggtggtgtagctgtttt | atactcaaaactcaacgaagaagagatctc | |
Mapping_target | C15C7 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Internal promoter | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00030963 | ||
Associations | Associated_with_gene | WBGene00015789 | ||
Remark | [131001 gw3] Promoter region driving expression in Larval and adult intestine and seam cells. | |||
Method | promoter |