WormBase Tree Display for Feature: WBsf019089
expand all nodes | collapse all nodes | view schema
WBsf019089 | SMap | S_parent | Sequence | F29F11 | |
---|---|---|---|---|---|
Name | Public_name | PHA-4 site 1 | |||
Sequence_details | Flanking_sequences | aagttgagcaaaaaagattacggtaagtgg | gataacgcggccgtatttttggatccaaaa | ||
Mapping_target | F29F11 | ||||
DNA_text | ACAAACA | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | This is a PHA-4 binding site for ceh-22. | |||
SO_term | SO:0000235 | ||||
Defined_by | Defined_by_paper | WBPaper00006411 | |||
WBPaper00005167 | Person_evidence | WBPerson1983 | |||
Associations | Associated_with_gene | WBGene00000445 | |||
Associated_with_Interaction | WBInteraction000521739 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000020 | ||||
Bound_by_product_of | WBGene00004013 | ||||
Remark | (forkhead) | ||||
This is the PHA-4 site number 1 as described in the paper. [2014-07-02 gw3] | |||||
Method | TF_binding_site |