WormBase Tree Display for Feature: WBsf014693
expand all nodes | collapse all nodes | view schema
| WBsf014693 | SMap | S_parent | Sequence | K02F3 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TGCTTTTGCCTAAACGGTGGTATTTTTCAG | CAAGGGACCAGTTTCAAGGTCCCACGACCG | |
| Mapping_target | K02F3 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL2 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_sequence (17) | |||
| Defined_by_analysis | RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 1 | ||
| RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 2 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 2 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 | 1 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 4 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 7 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085287 | 1 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 1 | |||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 | 2 | |||
| Associations | Associated_with_CDS | K02F3.4 | ||
| Associated_with_transcript | K02F3.4.1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085287 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 2 reads | ||||
| Method | SL2 |
