WormBase Tree Display for Feature: WBsf009044
expand all nodes | collapse all nodes | view schema
| WBsf009044 | SMap | S_parent | Sequence | R12C12 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TTCATTTCATTTTACTACTCGTGAATCTAG | AACCTTCACTCATCTCCAAAATGGTTCTCC | |
| Mapping_target | R12C12 | |||
| Origin | Species | Caenorhabditis elegans | ||
| History | Acquires_merge | WBsf010726 | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_sequence (24) | |||
| Defined_by_paper | WBPaper00037948 | |||
| Defined_by_analysis (58) | ||||
| Associations | Associated_with_CDS | R12C12.1a | ||
| Associated_with_transcript | R12C12.1a.1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 5 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 25 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001874 with 15 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 40 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004865 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 11 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 19 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000032.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008138 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008139 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 8 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 25 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 17 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 93 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 62 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 46 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA51225.SRX026729 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028202 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028203 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 35 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 11 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 23 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 31 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 15 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 20 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 12 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 35 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 33 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 with 12 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 with 20 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX050610 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 87 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103987 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 with 17 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 with 30 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103990 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 with 18 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 44 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.SRP016006.SRX191947 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.SRP016006.SRX191948 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.SRP016006.SRX191949 with 1 reads | ||||
| Method | SL1 |
