WormBase Tree Display for Feature: WBsf000238
expand all nodes | collapse all nodes | view schema
WBsf000238 | SMap | S_parent | Sequence | T18D3 | |
---|---|---|---|---|---|
Sequence_details | Flanking_sequences | ATAACAACATTTTTTTACAATATATTACAG | CTATTTCCTTTCAAAAATGATAGTACCGGA | ||
Mapping_target | T18D3 | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible | Description | SL1 trans-splice leader acceptor site | |||
SO_term | SO:0000706 | ||||
Defined_by | Defined_by_sequence | U16708 | Curator_confirmed | WBPerson1846 | |
Inferred_automatically | make_missing_tsl_features.pl | ||||
Defined_by_analysis | RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 | 2 | |||
RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 1 | ||||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 | 1 | ||||
RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 | 2 | ||||
Remark | Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 2 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 1 reads | |||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 1 reads | |||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 2 reads | |||||
Method | SL1 |