WormBase Tree Display for Variation: WBVar02157548

WBVar02157548 Evidence: Person_evidence: WBPerson282
  Name: Public_name: WBVar02157548
    Other_name (12)
    HGVSg: CHROMOSOME_III:g.3001206C>T
  Sequence_details: SMap: S_parent: Sequence: Y55D5A
    Flanking_sequences: tcagatagagctttcacttttttgccgtag gtacttgaatgtagtagtagattatacaac
    Mapping_target: Y55D5A
    Type_of_mutation: Substitution: C T Paper_evidence: WBPaper00060588
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: IW
    Status: Live
  Linked_to: WBVar02157253
  Affects: Gene: WBGene00000898
    Transcript: Y55D5A.5g.1 (12)
      Y55D5A.5e.1 (12)
      Y55D5A.5f.1 (12)
      Y55D5A.5a.1 (12)
      Y55D5A.5c.1 (12)
      Y55D5A.5d.1 (12)
  Genetics: Interpolated_map_position: III -8.12282
  Reference: WBPaper00060588
  Remark: alt_det = G to A mut_det = R1210H Person_evidence: WBPerson282
      Curator_confirmed: WBPerson51134
    [220329 skd] New Variation: connected to iw94. Curator_confirmed: WBPerson51134
    [220329 skd] Child allele curated by linking two child variants WBVar02157547 and WBVar02157548
    Variation information submitted by WBPerson282 on 2022-03-18_15:22:01 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). Curator_confirmed: WBPerson51134
    [2022-03-29T10:17:25.455Z WBPerson51134] New Variation: child variant of parent allele iw94(WBVar02157253). Mapping_target Y55D5A, mut_det = R1210H Curator_confirmed: WBPerson51134
    [2022-03-29T10:19:29.375Z WBPerson51134] Update Variation: name updated to remove non conventional public name Curator_confirmed: WBPerson51134
  Method: Substitution_allele