WormBase Tree Display for Variation: WBVar02157257

WBVar02157257 Evidence: Person_evidence: WBPerson282
  Name: Public_name: iw81
    Other_name: Y55D5A.5d.1:c.1153C>T
      Y55D5A.5a.1:c.1294C>T
      CE50158:p.Leu356Phe
      Y55D5A.5e.1:c.1066C>T
      CE46852:p.Leu432Phe
      Y55D5A.5c.1:c.1294C>T
      CE50204:p.Leu432Phe
      CE50312:p.Leu385Phe
    HGVSg: CHROMOSOME_III:g.3013267G>A
  Sequence_details: SMap: S_parent: Sequence: Y55D5A
    Flanking_sequences: cacgggtcacacaacgacgttgaaggagaa gtacaggtgagcatcacacttttcgataca
    Mapping_target: Y55D5A
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Origin: Species: Caenorhabditis elegans
    Status: Live
  Affects: Gene: WBGene00000898
    Transcript: Y55D5A.5e.1 (12)
      Y55D5A.5a.1 (12)
      Y55D5A.5c.1 (12)
      Y55D5A.5d.1 (12)
  Possibly_affects: WBGene00000898 Paper_evidence: WBPaper00060588
      Remark: CGC_name daf-2
  Isolation: Mutagen: EMS
  Genetics: Interpolated_map_position: III -8.05789
  Description: Phenotype: WBPhenotype:0000061 Paper_evidence: WBPaper00060588
        Curator_confirmed: WBPerson282
      WBPhenotype:0000637 Paper_evidence: WBPaper00060588
        Curator_confirmed: WBPerson282
  Reference: WBPaper00060588
  Remark: [2022-03-22T01:14:38.863Z WBPerson2987] New Variation: WBPaper00060588; allele of daf-2; Using Y55D5A.5a transcript predicted to generate a protein of 1,846 amino acids as the reference, the molecular changes are iw81 L432F (CTT to TTT)... Curator_confirmed: WBPerson2987
    alt_det = C to T mut_det = L432F Y55D5A.5a Person_evidence: WBPerson282
      Curator_confirmed: WBPerson51134
    Variation information submitted by WBPerson282 on 2022-03-18_15:21:59 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). Curator_confirmed: WBPerson51134
  Method: Substitution_allele