WormBase Tree Display for Variation: WBVar02154124
expand all nodes | collapse all nodes | view schema
| WBVar02154124 | Evidence | Person_evidence | WBPerson11663 | ||
|---|---|---|---|---|---|
| Name | Public_name | pan11 | |||
| Other_name | pan12 | ||||
| pan13 | |||||
| CE42903:p.Arg284Trp | |||||
| B0024.8a.1:c.850_852delinsTGG | |||||
| HGVSg | CHROMOSOME_V:g.10305902_10305904delinsCCA | ||||
| Sequence_details | SMap | S_parent | Sequence | B0024 | |
| Flanking_sequences | tacttgtttcattttttctaatcccgaaat | ttgattagcatctgtatcctcagcaattaa | |||
| Mapping_target | B0024 | ||||
| Type_of_mutation | Substitution | TCT | CCA | ||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00049321 | ||||
| Production_method | CRISPR_Cas9 | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00000491 | |||
| Transcript | B0024.8a.1 | VEP_consequence | missense_variant | ||
| VEP_impact | MODERATE | ||||
| HGVSc | B0024.8a.1:c.850_852delinsTGG | ||||
| HGVSp | CE42903:p.Arg284Trp | ||||
| cDNA_position | 879-881 | ||||
| CDS_position | 850-852 | ||||
| Protein_position | 284 | ||||
| Exon_number | 7/25 | ||||
| Codon_change | AGA/TGG | ||||
| Amino_acid_change | R/W | ||||
| Description | Phenotype | WBPhenotype:0000881 | Paper_evidence | WBPaper00060234 | |
| Curator_confirmed | WBPerson11663 | ||||
| WBPhenotype:0001251 | Paper_evidence | WBPaper00060234 | |||
| Curator_confirmed | WBPerson11663 | ||||
| WBPhenotype:0001526 | Paper_evidence | WBPaper00060234 | |||
| Curator_confirmed | WBPerson11663 | ||||
| WBPhenotype:0002212 | Paper_evidence | WBPaper00060234 | |||
| Curator_confirmed | WBPerson11663 | ||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00060234 | |||
| Curator_confirmed | WBPerson11663 | ||||
| Phenotype_not_observed | WBPhenotype:0000677 | Paper_evidence | WBPaper00060234 | ||
| Curator_confirmed | WBPerson11663 | ||||
| Disease_info | Models_disease | DOID:0060340 | |||
| Models_disease_in_annotation | WBDOannot00001295 | ||||
| Reference | WBPaper00060234 | ||||
| Remark | alt_det = AGA to TGG mut_det = R284W | Paper_evidence | WBPaper00060234 | ||
| Person_evidence | WBPerson11663 | ||||
| Curator_confirmed | WBPerson51134 | ||||
| The 30 bp flanking sequences correspond to the wild-type sequence flanking the mutated codon. However, in this region we introduced a number of silent mutations during the CRISPR-Cas9 editing. | Paper_evidence | WBPaper00060234 | |||
| Person_evidence | WBPerson12357 | ||||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson11663 on 2021-08-17_03:49:45 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Variation information submitted by WBPerson12357 on 2021-09-21_06:18:14 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| [2021-09-28T09:49:08.426Z WBPerson51134] New Variation: Other names pan12, pan13. Reference WBPaper00060234 | Curator_confirmed | WBPerson51134 | |||
| Method | Engineered_allele |
