WormBase Tree Display for Variation: WBVar02153254
expand all nodes | collapse all nodes | view schema
| WBVar02153254 | Name | Public_name | yan27 | ||
|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | C10C6 | |
| Flanking_sequences | taatagtctcgactagttggtcgacacc | catctttccgggctacaggaccctgcaaaa | |||
| Mapping_target | C10C6 | ||||
| SeqStatus | Sequenced | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00050577 | ||||
| Laboratory | ZOU | ||||
| Production_method | CRISPR_Cas9 | ||||
| Expr_pattern | Expr15216 | ||||
| Expr16003 | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00007514 | |||
| Transcript | C10C6.6.1 | ||||
| Possibly_affects | WBGene00007514 | Paper_evidence | WBPaper00060223 | ||
| Remark | CGC_name catp-8 | ||||
| Reference | WBPaper00060223 | ||||
| WBPaper00062068 | |||||
| Remark | [2020-12-09T15:23:15.668Z WBPerson12028] New Variation: catp- 8(yan27 ki[gfp::catp-8]; WBPaper00060223 | Curator_confirmed | WBPerson12028 | ||
| alt_det = gfp knock in | Paper_evidence | WBPaper00060223 | |||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by on 2021-12-22_22:02:05 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
| Method | Engineered_allele |
