WormBase Tree Display for Variation: WBVar02152473

WBVar02152473 Name: Public_name: tm12203
    Other_name: T19E7.2a.1:c.129+1049_130-591del
    HGVSg: CHROMOSOME_IV:g.5656499_5659207del
  Sequence_details: SMap: S_parent: Sequence: T19E7
    Flanking_sequences: atgttaaagtgaactatgaactgtctagag ctgctatcaagctggcatataggcaatcgg
    Mapping_target: T19E7
    Source_location: 7 CHROMOSOME_IV 5656498 5659208 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm12203_external
      tm12203_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12203
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00200201
      WBGene00199642
      WBGene00004804
    Transcript: T19E7.26 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      T19E7.2a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: T19E7.2a.1:c.129+1049_130-591del
        Intron_number: 1/8
      T19E7.27 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 4770/4771-7479/7480(2709 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele