WormBase Tree Display for Variation: WBVar02152367

WBVar02152367 Name: Public_name: tm12082
    Other_name (16)
    HGVSg: CHROMOSOME_V:g.6908511_6908652del
  Sequence_details: SMap: S_parent: Sequence: K11C4
    Flanking_sequences: atgacaaactgaacctgagattaagccttt gataggaaagaagaggatagaaaagttttg
    Mapping_target: K11C4
    Source_location: 7 CHROMOSOME_V 6908510 6908653 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm12082_external
      tm12082_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12082
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006801
    Transcript (16)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Remark: 27329/27330-27471/27472(142 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele