WormBase Tree Display for Variation: WBVar02151700
expand all nodes | collapse all nodes | view schema
WBVar02151700 | Name | Public_name | tm11365 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | acatgaaaaaatgtaactgtacaaaaagct | attcaaactagagacaatttttcagtacgt | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 7 | CHROMOSOME_IV | 4160294 | 4193699 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm11365_external | |||||||
tm11365_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 11365 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene (17) | |||||||
Transcript (16) | ||||||||
Pseudogene | K08D10.18 | |||||||
K08D10.15 | ||||||||
K06B9.2 | ||||||||
K08D10.9 | ||||||||
K06B9.4 | ||||||||
K08D10.5 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Remark | [K08D10]6367/6368-[K06B9]7331/7332 (33404 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target K08D10 updated based on the VEP analysis pipeline to CHROMOSOME_IV. | ||||||||
Method | NBP_knockout_allele |