WormBase Tree Display for Variation: WBVar02151549

WBVar02151549 Name: Public_name: tm11208
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: aaaaataatttgatggtatggtgcatttaa gtgcaacaaaataaacaattaattttggca
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 8997418 9020504 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11208_external
      tm11208_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11208
    NBP_allele
    Status: Live
  Affects: Gene (13)
    Transcript (15)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Remark: [F32H2]38220/38221-[F36F2]20537/20538 (23085 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F32H2 updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele