WormBase Tree Display for Variation: WBVar02151441

WBVar02151441 Name: Public_name: tm11092
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: tcaggctgtgccatttcggtttgatctaca gccgacacattcggggttccgcagattttc
    Mapping_target: CHROMOSOME_IV
    Source_location: 7 CHROMOSOME_IV 3230803 3266957 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm11092_external
      tm11092_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 11092
    NBP_allele
    Status: Live
  Affects: Gene (11)
    Transcript (21)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: [Y67D8A]13737/13738-[T26C12]11909/11910 (36153 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y67D8A updated based on the VEP analysis pipeline to CHROMOSOME_IV.
  Method: NBP_knockout_allele