WormBase Tree Display for Variation: WBVar02151302

WBVar02151302 Name: Public_name: tm10947
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: gtttcttgacatttcttattcttaaaagtt ggaaaaggtgcgcgaggtgtctcgccgtcg
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 4228074 4271841 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10947_external
      tm10947_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10947
    NBP_allele
    Status: Live
  Affects: Gene (13)
    Transcript (30)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Remark: [C18E3]43043/43044-[C43E11]42837/42838 (43766 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target C18E3 updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele