WormBase Tree Display for Variation: WBVar02151287

WBVar02151287 Name: Public_name: tm10932
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: ttttaacttttccataaaacacttgcattt ggatataaggaaccagaaaaccttttgtct
    Mapping_target: CHROMOSOME_IV
    Source_location: 7 CHROMOSOME_IV 16452871 16479306 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10932_external
      tm10932_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10932
    NBP_allele
    Status: Live
  Affects: Gene (95)
    Transcript (92)
    Pseudogene: VY10G11R.2
      VY10G11R.3
      VY10G11R.4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: [VY10G11R]1984/1985-[Y51H4A]7470/7471 (26434 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target VY10G11R updated based on the VEP analysis pipeline to CHROMOSOME_IV.
  Method: NBP_knockout_allele