WormBase Tree Display for Variation: WBVar02151154
expand all nodes | collapse all nodes | view schema
WBVar02151154 | Name | Public_name | tm10792 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | ttggaaaatctcatcgagagcgacgatggg | ctcctaactccgcccctttagagccatccc | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Source_location | 7 | CHROMOSOME_X | 3512836 | 3545326 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 10792 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006864 | ||||||
WBGene00006863 | ||||||||
WBGene00166183 | ||||||||
WBGene00004350 | ||||||||
WBGene00018937 | ||||||||
WBGene00199515 | ||||||||
Transcript (15) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Remark | [C12D12]28465/28466-[F56B6]23709/23710 (32489 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C12D12 updated based on the VEP analysis pipeline to CHROMOSOME_X. | ||||||||
Method | NBP_knockout_allele |