WormBase Tree Display for Variation: WBVar02151152
expand all nodes | collapse all nodes | view schema
WBVar02151152 | Name | Public_name | tm10790 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | gctacgtacggttcatacgaatattgatat | tcaagcttgaatgccagtactttctcctgg | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 7 | CHROMOSOME_II | 5570213 | 5587791 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm10790_external | |||||||
tm10790_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 10790 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene (11) | |||||||
Transcript (17) | ||||||||
Pseudogene | C17G10.3 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Remark | [C17C3]40104/40105-[C17G10]5519/5520 (17577 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C17C3 updated based on the VEP analysis pipeline to CHROMOSOME_II. | ||||||||
Method | NBP_knockout_allele |