WormBase Tree Display for Variation: WBVar02151152

WBVar02151152 Name: Public_name: tm10790
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: gctacgtacggttcatacgaatattgatat tcaagcttgaatgccagtactttctcctgg
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 5570213 5587791 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10790_external
      tm10790_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10790
    NBP_allele
    Status: Live
  Affects: Gene (11)
    Transcript (17)
    Pseudogene: C17G10.3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Remark: [C17C3]40104/40105-[C17G10]5519/5520 (17577 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target C17C3 updated based on the VEP analysis pipeline to CHROMOSOME_II.
  Method: NBP_knockout_allele