WormBase Tree Display for Variation: WBVar02151094

WBVar02151094 Name: Public_name: tm10723
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_IV
    Flanking_sequences: aaaatttcttataaaattgtctacattttg tggtggaaatggtttggcaaacccgttgac
    Mapping_target: CHROMOSOME_IV
    Source_location: 7 CHROMOSOME_IV 3573085 3593534 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm10723_external
      tm10723_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 10723
    NBP_allele
    Status: Live
  Affects: Gene (13)
    Transcript (21)
    Pseudogene: Y37E11B.t2
      Y37E11B.t1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: [B0212]32946/32947 - [Y37E11B]15757/15758 (20449 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target B0212 updated based on the VEP analysis pipeline to CHROMOSOME_IV.
  Method: NBP_knockout_allele