WormBase Tree Display for Variation: WBVar02150893

WBVar02150893 Name: Public_name: tm4898
    Other_name: R12H7.2.1:c.506_786del
      CE03567:p.Ser170HisfsTer35
    HGVSg: CHROMOSOME_X:g.13219677_13220168del
  Sequence_details: SMap: S_parent: Sequence: R12H7
    Flanking_sequences: tccctttctggtgactggaacataggtgat cctttgaaatgaatcccttcatggatccag
    Mapping_target: R12H7
    Source_location: 7 CHROMOSOME_X 13219676 13220169 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4898_external
      tm4898_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4898
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000217
    Transcript: R12H7.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Remark: 15555/15556-16047/16048 (492 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele