WormBase Tree Display for Variation: WBVar02150586

WBVar02150586 Name: Public_name: tm13125
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_III
    Flanking_sequences: gctaaatctgaacattggctcaaaagttat ggagtgcaatggatgacgtcacatgggtga
    Mapping_target: CHROMOSOME_III
    Source_location: 7 CHROMOSOME_III 10950319 10994206 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm13125_external
      tm13125_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 13125
    NBP_allele
    Status: Live
  Affects: Gene (16)
    Transcript (15)
    Pseudogene: W05B2.3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Remark: [Y48A6A]2804/2805-[Y48A6B]4061/4062(43886 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y48A6A updated based on the VEP analysis pipeline to CHROMOSOME_III.
  Method: NBP_knockout_allele