WormBase Tree Display for Variation: WBVar02150227

WBVar02150227 Name: Public_name: tm12664
    HGVSg: CHROMOSOME_IV:g.3915506_3915918del
  Sequence_details: SMap: S_parent: Sequence: F56D6
    Flanking_sequences: aaaactttttttcatgctgtgatcttcaaa ctgtaataatttttatcattcttgcttata
    Mapping_target: F56D6
    Source_location: 7 CHROMOSOME_IV 3915505 3915919 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm12664_external
      tm12664_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 12664
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018973
    Transcript: F56D6.5a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-261
        CDS_position: ?-247
        Protein_position: ?-83
        Intron_number: 2/7
        Exon_number: 1-3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 25306/25307-25719/25720(413 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele