WormBase Tree Display for Variation: WBVar02150060
expand all nodes | collapse all nodes | view schema
| WBVar02150060 | Evidence | Paper_evidence | WBPaper00058674 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | sy879 | |||||
| Other_name | CE26385:p.Asp66Glu | ||||||
| T07A9.6.1:c.198C>G | |||||||
| HGVSg | CHROMOSOME_IV:g.424951G>C | ||||||
| Sequence_details | SMap | S_parent | Sequence | T07A9 | |||
| Flanking_sequences | tcgttgtcgcaccgagtaccaaaatatcga | ctagattgtgcatgtaaggcacttctcttg | |||||
| Mapping_target | T07A9 | ||||||
| Type_of_mutation | Substitution | c | r | Curator_confirmed | WBPerson1983 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00047062 | Curator_confirmed | WBPerson1983 | ||||
| Laboratory | PS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000913 | |||||
| Transcript | T07A9.6.1 (12) | ||||||
| Genetics | Interpolated_map_position | IV | -26.0086 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000013 | Paper_evidence | WBPaper00058674 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Image | WBPicture0000014933 | Paper_evidence | WBPaper00058674 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00058674 | ||||||
| Remark | Created in the nameserver by Karen Yook | ||||||
| WBPaper00058674 daf-18 D66E | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00000913 Missense 66 D to E | Paper_evidence | WBPaper00058674 | |||||
| Method | Substitution_allele |
