WormBase Tree Display for Variation: WBVar02149844
expand all nodes | collapse all nodes | view schema
| WBVar02149844 | Evidence | Paper_evidence | WBPaper00056582 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ot268 | |||||||
| Sequence_details | SeqStatus | Pending_curation | |||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00047395 | ||||||||
| Laboratory | OH | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003008 | |||||||
| Description | Phenotype | WBPhenotype:0002496 | Paper_evidence | WBPaper00056582 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | lin-22 mutant alleles display an ectopic expression of dat-1::gfp (vtIs1 | Paper_evidence | WBPaper00056582 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006747 | PATO:0000460 | Paper_evidence | WBPaper00056582 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00056582 | ||||||||
| Remark | Created in the nameserver by Karen Yook | ||||||||
| WBPaper00056582 lin-22 C to T in TGATATTCTCGAAATGGCTGT | |||||||||
| Method | Allele |
