WormBase Tree Display for Variation: WBVar02144271

WBVar02144271 Name: Public_name: tm7242
    Other_name: R102.11a.1:c.64+26_64+118del
    HGVSg: CHROMOSOME_IV:g.10699385_10699477del
  Sequence_details: SMap: S_parent: Sequence: R102
    Flanking_sequences: tcgagaacgattgcggtttctaatcatgat ggaatttcaaatagttcaaacttaccgaaa
    Mapping_target: R102
    Source_location: 7 CHROMOSOME_IV 10699384 10699478 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7242_external
      tm7242_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7242
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00077714
      WBGene00011293
    Transcript: R102.6.2 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1211-?
        Exon_number: 9/9
      R102.6.3 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1125-?
        Exon_number: 8/8
      R102.6.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1265-?
        Exon_number: 9/9
      R102.11a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: R102.11a.1:c.64+26_64+118del
        Intron_number: 2/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Remark: 14660/14661-14753/14754 (93 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele