WormBase Tree Display for Variation: WBVar02144068

WBVar02144068 Name: Public_name: tm7119
    HGVSg: CHROMOSOME_IV:g.10408963_10409781del
  Sequence_details: SMap: S_parent: Sequence: R10H10
    Flanking_sequences: atgagaatatatattggctaatagtgaaat cgattttaacaacaaaattatcgtatcgag
    Mapping_target: R10H10
    Source_location: 7 CHROMOSOME_IV 10408962 10409782 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm7119_external
      tm7119_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 7119
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011224
    Transcript: R10H10.6.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 1/2
        Exon_number: 1/3
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 27507/27508-28326/28327 (819 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele