WormBase Tree Display for Variation: WBVar02125364
expand all nodes | collapse all nodes | view schema
| WBVar02125364 | Evidence | Paper_evidence | WBPaper00044909 | ||
|---|---|---|---|---|---|
| Name | Public_name | qSi26 | |||
| Sequence_details | Flanking_sequences | ATTCCATGATGGTAGCAAACTCACTTCGTG | TAAGTGCAAGTAAGATCAGTGTTTGTTTCG | ||
| Mapping_target | F14E5 | ||||
| Type_of_mutation | Insertion | TA | |||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Transposon_insertion | Mos1 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00006687 | ||||
| WBStrain00022657 | |||||
| Laboratory | JK | ||||
| Status | Dead | Curator_confirmed | WBPerson1983 | ||
| Reference | WBPaper00044909 | ||||
| Remark | Removed qSi26 as a variation as this is a transgene ID; Created incorrectly during the automatic Strain import from the CGC as well some manually from publications. | ||||
| Method | Transposon_insertion |
