WormBase Tree Display for Variation: WBVar02124451
expand all nodes | collapse all nodes | view schema
WBVar02124451 | Name | Public_name | WBVar02124451 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855374 | |||||||
Sequence_details | SMap | S_parent | Sequence | D1081 | ||||
Flanking_sequences | CAATAATACTTTTGTTTCAGGCATTCGAAC | ATATCGACTTGGAAAAGCGATACAAAAACC | ||||||
Mapping_target | D1081 | |||||||
Source_location | 225 | CHROMOSOME_I | 8461001 | 8473000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027647 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00045508 | ||||||
WBGene00006844 | ||||||||
WBGene00171005 | ||||||||
WBGene00304981 | ||||||||
WBGene00201589 | ||||||||
WBGene00008381 | ||||||||
WBGene00050879 | ||||||||
Transcript | D1081.19a.1 | |||||||
D1081.10.1 | ||||||||
D1081.11.1 | ||||||||
D1081.10.2 | ||||||||
D1081.13 | ||||||||
D1081.19b.1 | ||||||||
D1081.3.1 | ||||||||
D1081.2.1 | ||||||||
D1081.17 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |