WormBase Tree Display for Variation: WBVar02124298
expand all nodes | collapse all nodes | view schema
WBVar02124298 | Name | Public_name | WBVar02124298 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00855221 | |||||||
Sequence_details | SMap | S_parent | Sequence | F48F7 | ||||
Flanking_sequences | CTTCTTCTAGACAAGTTGCTATCAGTTTTC | TAGCCTGGCGTTGCCGAATGAAGCTTCATT | ||||||
Mapping_target | F48F7 | |||||||
Source_location | 225 | CHROMOSOME_X | 13959504 | 13974071 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004126 | ||||||
WBGene00009849 | ||||||||
WBGene00006372 | ||||||||
Transcript | F48F7.2.1 | |||||||
F48F7.4.1 | ||||||||
F48F7.3.1 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |