WormBase Tree Display for Variation: WBVar02123791
expand all nodes | collapse all nodes | view schema
WBVar02123791 | Name | Public_name | WBVar02123791 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854714 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | TTAACGGATAAGGATATTAATTTGTTTCTG | TTCCTCTAGGCGTCACCTGGAATATTTTGG | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 225 | CHROMOSOME_II | 1537001 | 1638000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022899 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (44) | |||||||
Transcript (39) | ||||||||
Pseudogene | C08E3.11 | |||||||
K05F6.15 | ||||||||
K05F6.16 | ||||||||
C08E3.5 | ||||||||
C08E3.4 | ||||||||
C08E3.2 | ||||||||
T07H3.10 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |