WormBase Tree Display for Variation: WBVar02123536
expand all nodes | collapse all nodes | view schema
| WBVar02123536 | Name | Public_name | WBVar02123536 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | cewivar00854459 | |||||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
| Flanking_sequences | GAATTTACGATAAAATTGGAGTGGAGGAAG | ACATTTTGAGTGCGGAATCTTTCAAGCGTA | ||||||
| Mapping_target | CHROMOSOME_V | |||||||
| Source_location | 225 | CHROMOSOME_V | 18143001 | 18310000 | From_analysis | Million_mutation_project_reanalysis | ||
| Type_of_mutation | Deletion | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00022868 | From_analysis | Million_mutation_project_reanalysis | |||||
| WBStrain00022930 | From_analysis | Million_mutation_project_reanalysis | ||||||
| Laboratory | VC | |||||||
| Analysis | Million_mutation_project_reanalysis | |||||||
| Status | Live | |||||||
| Affects | Gene (75) | |||||||
| Transcript (66) | ||||||||
| Pseudogene (17) | ||||||||
| Remark | The boundaries of this variant have been identified only approximately | |||||||
| This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
| Method | WGS_Flibotte |
