WormBase Tree Display for Variation: WBVar02122912
expand all nodes | collapse all nodes | view schema
WBVar02122912 | Name | Public_name | WBVar02122912 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853835 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | AGGACGACGACGTGATGGAAGAGGAGCTCC | AAGCGTAAGTCTAAGCACAAGCCTGAACCT | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 225 | CHROMOSOME_II | 2830001 | 2848000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023192 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004210 | ||||||
WBGene00019687 | ||||||||
WBGene00168892 | ||||||||
WBGene00200083 | ||||||||
WBGene00022444 | ||||||||
WBGene00195503 | ||||||||
WBGene00022443 | ||||||||
WBGene00019686 | ||||||||
WBGene00022441 | ||||||||
Transcript (12) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |