WormBase Tree Display for Variation: WBVar02122867
expand all nodes | collapse all nodes | view schema
WBVar02122867 | Name | Public_name | WBVar02122867 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853790 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | ACGTTCAACATGCAATATCTGTAATTGAAA | AAAACTTCATCTTCAACGAAATTATAATTT | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 17624001 | 17657000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023191 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (14) | |||||||
Transcript (12) | ||||||||
Pseudogene | F59A1.9 | |||||||
F59A1.8 | ||||||||
F57G4.4 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |