WormBase Tree Display for Variation: WBVar02122704
expand all nodes | collapse all nodes | view schema
WBVar02122704 | Name | Public_name | WBVar02122704 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853627 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | TCTGGTCGTCAAGTTCAGGATGTTCTAGCT | CAAAGAAAAAACCATGAAGTCCCATCCACA | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 18698001 | 18786000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023139 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00027660 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00027662 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (46) | |||||||
Transcript (32) | ||||||||
Pseudogene (14) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |