WormBase Tree Display for Variation: WBVar02122139
expand all nodes | collapse all nodes | view schema
WBVar02122139 | Name | Public_name | WBVar02122139 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853062 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | TTGTGGAATATGCAAACAGGATCCTGGAGT | GGCCGAGAAATCAGTGAGTTTACTGTTGCT | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 4118001 | 4200000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006640 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (40) | |||||||
Transcript (42) | ||||||||
Pseudogene | F49F1.8 | |||||||
K06B9.4 | ||||||||
F49F1.13 | ||||||||
K08D10.5 | ||||||||
R07C12.4 | ||||||||
K08D10.18 | ||||||||
K08D10.15 | ||||||||
R07C12.2 | ||||||||
K06B9.2 | ||||||||
K08D10.9 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |