WormBase Tree Display for Variation: WBVar02121836

WBVar02121836 Name: Public_name: WBVar02121836
    Other_name: cewivar00852759
  Sequence_details: SMap: S_parent: Sequence: K01A2
    Flanking_sequences: TTAAAAAATTTTTAAAATTTTCAAAAATTT CTTTATTTAATTTTCAAGAAATTTTCAGTT
    Mapping_target: K01A2
    Source_location: 225 CHROMOSOME_II 307001 325000 From_analysis: Million_mutation_project_reanalysis
    Type_of_mutation: Tandem_duplication
    SeqStatus: Sequenced
  Variation_type: Natural_variant
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00006631 From_analysis: Million_mutation_project_reanalysis
    Laboratory: VC
    Analysis: Million_mutation_project_reanalysis
    Status: Live
  Affects: Gene (12)
    Transcript (20)
    Pseudogene: K01A2.3b
      K01A2.3a
  Remark: The boundaries of this variant have been identified only approximately
    This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous
  Method: WGS_Flibotte